Users Online: 641 Home Print this page Email this page Small font sizeDefault font sizeIncrease font size
 

 

Home About us Editorial board Search Ahead of print Current issue Archives Submit article Instructions Subscribe Contacts Login 
     

 Table of Contents  
ORIGINAL ARTICLE
Year : 2022  |  Volume : 66  |  Issue : 5  |  Page : 36-40  

Breakthrough infection with SARS-CoV-2 delta variant in old-age homes in a Southern District of Kerala, India


1 Junior Resident, Department of Community Medicine, Government Medical College, Thiruvananthapuram, Kerala, India
2 Director, Institute of Advanced Virology, Thiruvananthapuram, Kerala, India
3 Senior Resident, Department of Community Medicine, Government Medical College, Thiruvananthapuram, Kerala, India
4 Assistant Surgeon, Department of Health Services, Kerala, India

Date of Submission10-Aug-2022
Date of Decision18-Aug-2022
Date of Acceptance19-Aug-2022
Date of Web Publication11-Nov-2022

Correspondence Address:
Kannamkottapilly Chandrasekharan Prajitha
ICMR-NIMR, Chennai, Tamil Nadu
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/ijph.ijph_1084_22

Rights and Permissions
   Abstract 


Background: The incidence of breakthrough infection with the emergence of new variants of concern of SARS-CoV-2 is posing a threat, and it is pertinent to understand the role of vaccines in protecting the elderly and people with comorbidities. Objective: The present study was undertaken to understand the natural history of SARS-CoV-2 infection in a closed cohort of the elderly population in an old-age home who have received two doses of COVID-19 vaccination. The study has also undertaken genomic sequencing to identify SARS-CoV-2 variants of concern from an academic perspective. Materials and Methods: A prospective observational study was conducted from March to August 2021 among residents of 11 old-age homes in Kerala who were vaccinated with 2 doses of the COVID-19 vaccine, from 2 weeks following vaccination. Samples with a threshold cycle value of <25 were subjected to targeted sequencing of the spike protein receptor-binding domain coding region. Results: Among the 479 vaccinated individuals, 86 (17.95%) turned positive during the follow-up period. The mean duration of symptoms was 3–5 days, and no hospitalization was required. A phylogenetic analysis of the nucleotide sequences from the samples indicated B.1.617.2 lineage representing the Delta strain. Conclusion: The evidence supports maximizing the vaccine coverage among vulnerable groups to prevent hospitalization and death rate on the verge of the emergence of new variants of SARS-CoV-2.

Keywords: B.1.617.2 SARS-CoV-2 variant, breakthrough COVID-19 infections, COVID vaccines, SARS-CoV-2


How to cite this article:
Chandran D, Sreekumar E, Prajitha KC, Sharahudeen A, Raveendran CL, Research team. Breakthrough infection with SARS-CoV-2 delta variant in old-age homes in a Southern District of Kerala, India. Indian J Public Health 2022;66, Suppl S1:36-40

How to cite this URL:
Chandran D, Sreekumar E, Prajitha KC, Sharahudeen A, Raveendran CL, Research team. Breakthrough infection with SARS-CoV-2 delta variant in old-age homes in a Southern District of Kerala, India. Indian J Public Health [serial online] 2022 [cited 2022 Nov 29];66, Suppl S1:36-40. Available from: https://www.ijph.in/text.asp?2022/66/5/36/360649

Research team
Sujatha Chintha, Thekkumkara Surendran Anish
Associate Professor, Department of Community Medicine, Government Medical College, Thiruvananthapuram, Kerala, India





   Introduction Top


The SARS-CoV-2 outbreak originated in Wuhan, China, in December 2019 has evolved as a worldwide pandemic.[1] High mortality of SARS-CoV-2 pandemics was noticed among elderly individuals.[2] Furthermore, the considerable high prevalence of comorbidities, such as diabetes, hypertension, and coronary heart disease, among the elderly has contributed to the severity of illness during COVID-19 infection.[3] In a study of case series of hospitalized patients with COVID-19-infected pneumonia, 26% of intensive care unit-admitted patients were of age above 65 years and 72.2% had comorbidities.[4] Elderly populations living in nursing homes are more susceptible to the infection since residents share common sources of air, food, water, and health care in crowded institutionalized settings. In addition, a complex and persistent route of transmission is established with the community because of the constant movement of visitors and staff.[5]

The disastrous effect of SARS-CoV-2 can be mitigated only by adhering to COVID-appropriate behaviors and taking vaccination.[1] Among the vulnerable individuals with comorbidities, the vaccine is found to have a great impact in reducing the incidence, hospitalizations, and deaths due to COVID-19 infection.[6]

The Government of Kerala issued guidelines to prevent the clusters of COVID-19 in old-age homes from the start of the pandemic. Old-age homes were considered bio-bubbles, and entry to and exit from these institutions were strictly checked. Despite these stringent measures and precautions, clustering of cases was reported in a few old-age homes in the state of Kerala.[7] This study aimed to understand the natural history of SARS-CoV-2 infection in a closed cohort of the elderly population who have received two doses of COVID-19 vaccination. The study has also undertaken genomic sequencing to identify SARS-CoV-2 variants of concern from an academic perspective.


   Materials and Methods Top


Ethics statement

Ethics clearance for this study was obtained from the Human Ethics Committee, Government Medical College, Thiruvananthapuram, Kerala (HEC NO.: 06/23/2021/MCT). The data were collected after obtaining informed written consent from the participants.

Study design, setting, and participants

A prospective observational study was conducted among the 479 elderly individuals residing in 11 old-age homes in the field area of a primary health center located in Thiruvananthapuram district of Kerala, India. The residents of the old-age home were vaccinated with two doses of COVID-19 vaccine (Covishield [ChAdOx1 nCoV-19 Coronavirus Vaccine-Recombinant]), 6 weeks apart, between March 2021 and May 2021. The old-age home received the vaccination as a part of a special campaign undertaken by the district administration to reduce COVID-19 morbidity and mortality through targeted vaccinations of elderly residents at the old-age homes of the district, and they were later followed up for any COVID-19 infection. This study reports the data collected during the follow-up period, from June to August 2021.

Timeline of COVID-19 vaccination

The special campaign to vaccinate all the residents of 11 old-age homes was commenced at the beginning of March 2021, and by end of the month, all residents were provided with the first dose of vaccine. The second dose was recommended after 6 weeks of the first dose as per the guidelines. The second dose of vaccine was administered to all the residents who received the first dose, and all the residents were fully vaccinated by the end of May 2021.

Identification of the infection

The vulnerable and high risk individuals living in closed communities were under the surveillance of the district administration and a mobile sample collection team comprising of a doctor, a staff nurse, and a nursing assistant conducted the screening tests for COVID-19 infection once in every two months. The screening tests had also been conducted if any probable case was reported from any institution in the district. Around 2 weeks after the completion of two-dose vaccination in all the 11 old-age homes, a fully vaccinated nursing staff in one of the institutions developed anosmia and tested reverse transcription–polymerase chain reaction (RT-PCR) positive for COVID-19 following which all the residents in that particular institution were screened. The residents living in other ten old-age homes were also followed up for any symptoms and were also screened for infection 1 month later as a precautionary measure. The samples were transported to the RT-PCR laboratory within 6 h of collection and tested using CoviPath COVID-19 RT-PCR Kit (multiplex real-time RT-PCR test intended for the qualitative detection of nucleic acid from SARS-CoV-2). The diagnosis is made by the detection of ORF 1-b and N genes.

Data collection tools and techniques

RT-PCR test was performed for all residents irrespective of symptoms. The samples with a Ct value of less than 25 were subjected to targeted sequencing of the spike protein receptor-binding domain (RBD) coding region to understand the SARS-CoV-2 variant associated with the cluster of breakthrough infections. Data on demography, comorbidity status, and symptom profile were collected using a semi-structured questionnaire. Social and environmental factors were largely adjusted by the fact that all the residents share similar habitats staying in the old-age home.

Analysis

Statistical analysis

The data were coded and entered into Microsoft Excel. Statistical analysis was done using IBM SPSS Statistics for Windows (Version 25.0. Armonk, NY, USA: IBM Corp). Baseline participant characteristics were summarized using mean and standard deviation (SD) for normally distributed continuous variables and median with interquartile range for nonnormally distributed variables. Categorical variables were expressed in percentages.

Spike protein receptor-binding domain coding region sequencing

Viral RNA isolated from throat swab samples was subjected to RT-PCR amplification of the RBD region using AccessQuick RT-PCR system (Promega, USA). The specific primers forward: 5'ACTTTAGAGTCCAACCAACAGA3' and reverse: 5'GACTCAGTAAGAACACCTGTGC3' were used for amplification. The PCR products were purified using the QIAquick Gel band purification system (QIAGEN, Germany). Two microliters of the purified product was subjected to sequencing using the BigDye Terminator Cycle Sequencing System (Applied Biosystems, ABI, USA) and was analyzed in an ABI 3730XL Genetic Analyzer. High-quality reads were compared with the sequences of the SARS-CoV-2 reference strain (GenBank Accession No. NC_045512) by sequence alignment of the translated amino acid sequences with the corresponding RBD regions and variants were identified.


   Results Top


Among the 479 elderly vaccinated individuals living in 11 old-age homes, 86 (17.95%) residents from 4 old-age homes were found to have the infection during the study period. A large cluster of 63 cases was reported from a single institution from where an index case, a health-care worker of the institution, turned positive 2 weeks following the completion of vaccination [Table 1]. Genomic sequencing was carried out on the positive samples collected from that particular institution to identify the variant.
Table 1: Details of breakthrough infection in 11 old-age homes

Click here to view


Sociodemographic characteristics

Among the infected people (N = 86), 56 (65.1%) were men and 30 (34.9%) were women, with a mean (SD) age of 66 (10.51) years. Around 87% (75) of them are known to have at least one comorbidity. Hypertension was reported by 45 (52.3%), diabetes by 24 (27.9%), and 32 (37.2%) reported to be suffering from mental illness. Multimorbidity was reported by 42 (48.8%) [Table 2].
Table 2: Proportion of individuals with different comorbidities

Click here to view


Symptomatology

Out of 86 positive cases, 74 individuals (86%) were asymptomatic. The symptomatic patients were of age above 60 years and 11 were male. Among the symptomatic 12 patients, 6 reported dry cough, 3 reported sore throat alone, and 3 patients had sore throat along with fever. None of them progressed to severe disease or required hospital admission.

Receptor-binding domain genomic region sequencing

All the 63 persons who tested positive for both the genes of SARS-CoV-2 showed Ct <34. However, only eight samples could be used in the sequence analysis based on the Ct value cutoff and amplification in the first round of RBD PCR. All these samples were subjected to sequencing of a 714 bp region coding for the RBD by Sanger's sequencing. Both forward and reverse strands were sequenced and analyzed independently. The amplified region sequences of all eight strains had 100% identity at the nucleotide level and amino acid level. A phylogenetic analysis of the nucleotide sequences with other B lineage strains indicated a close clustering of the samples from the breakthrough infection with the B.1.617.2 lineage representing the Delta strain [Figure 1]. Comparison of the derived amino acid sequences with the corresponding region of the reference strain identified the amino acid variations L452R and T478K, reconfirming that all of them belonged to the Delta variant, as per the pangolin database classification [Figure 2].
Figure 1: Maximum-likelihood phylogenetic analysis with 1000 boot-strap replications of the SARS-COV-2 spike protein RBD coding region nucleotide sequences from selected samples included in the study with representative B lineage strains and the SARS-CoV-2 Wuhan strain. GenBank accession numbers are indicated for reference strains. Samples used in the present study are represented by red triangles, RBD: Receptor-binding domain

Click here to view
Figure 2: Amino acid sequence alignment of RBD domain indicating the key mutations defining the B.1.617, RBD: Receptor-binding domain

Click here to view



   Discussion Top


The breakthrough infections have been reported in several nations among a small proportion of fully vaccinated individuals.[8] Despite the old age and several other risk factors due to comorbidities, none of them among the infected individuals required hospitalization, and only 13.9% were symptomatic. These findings are consistent with the documented evidence of mild or asymptomatic nature of breakthrough infections in other nations including India.[8],[9]

The ChAdOx1 adenovirus vector vaccine is reported to have an efficacy of 63.09% against symptomatic SARS-CoV-2 infection.[10] Recent studies provide evidence of reduced neutralization capacity of COVID-19 vaccines against different variants of concern. There are studies on individuals vaccinated with ChAdOx1 vaccine and mRNA vaccines with reports of reduction in neutralization potential of their sera against Beta variant.[11] A 5.8-fold reduction in neutralization against Delta compared to a reference was found among individuals who received two doses of Pfizer-BioNTech(Comirnaty) whereas 2.6- and 4.9-fold reductions against Alpha and Beta variants, respectively.[12] In another study, 81%–100% of samples were able to neutralize Alpha, Beta, and Delta 5 weeks after the second dose of Pfizer-BioNTech(Comirnaty). The findings were consistent at 13 weeks; the exception being only 46% of the samples could neutralize Beta strain. This study also found that a single dose of AstraZeneca-Vaxzevria, while able to neutralize Alpha, was less effective at neutralizing Beta or Delta.[13]

In several nations, the proportion of reported vaccine breakthrough infections has been attributed to variants of concern, and in India, Delta and Delta plus variants are raising concerns.[14],[15] In addition, studies on Delta variants from the United Kingdom report an increased risk of severe disease and increased transmissibility. Secondary attack rates have been demonstrated to be higher for Delta than Alpha in both traveler and nontraveler cases and among both household and nonhousehold contacts.[16] The COVID-19 vaccines prepared using SARS-CoV-2 strains before the emergence of variants of concerns may not be highly efficient to prevent breakthrough infection due to strains like Delta, to which the immune escape phenomenon is already documented.[17] However, vaccination help in reducing the morbidity and mortality due to COVID-19 infection among the vulnerable groups. The rapid spread of infection among the residents, though vaccinated, can be attributed to the high transmissibility of Delta variant. The evidence on the asymptomatic status of the vaccinated residents in congruence with data from different settings highlights the importance of vaccination among high-risk individuals in a congregate setting.[15],[18] Among the study participants, none of them developed any fatalities and recovered from symptoms in a week in the old-age home care facility. This is contrary to the existing evidence on the estimated mortality due to SARS-CoV 2 infection among the elderly, especially above 76 years of age, which is reportedly 18%, and also in India, 53% of the fatalities were among the elderly population, thereby highlighting the importance of vaccination among elderly and vulnerable population.[19],[20]


   Conclusion Top


The evidence from this study supports maximizing the vaccine coverage among these highly vulnerable groups to prevent hospitalization and death rate at the verge of the emergence of new variants of SARS-CoV-2 infection.

Limitation

The primary data collection from the uninfected individuals was not attempted to avoid cross-infection in this highly vulnerable group which precluded further comparative quantitative analysis in the study.

Acknowledgment

We acknowledge the district administration of Thiruvananthapuram for providing vaccines for the local initiative. We acknowledge the technical support by Ms. Sreeja Vinod and Genomics Core (Dr. Manoj and Mr. Bharath) of RGCB for carrying out the viral genome sequencing. We also like to thank our study participants for their cooperation.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.



 
   References Top

1.
Moore S, Hill EM, Tildesley MJ, Dyson L, Keeling MJ. Vaccination and non-pharmaceutical interventions for COVID-19: A mathematical modelling study. Lancet Infect Dis 2021;21:793-802.  Back to cited text no. 1
    
2.
Shahid Z, Kalayanamitra R, McClafferty B, Kepko D, Ramgobin D, Patel R, et al. COVID-19 and older adults: What we know. J Am Geriatr Soc 2020;68:926-9.  Back to cited text no. 2
    
3.
Regy MM, Kiran PR, Gnanaselvam NA. Anxiety and Resilience among the Elderly During the Covid-19 Related Lockdown in Anekal, Karnataka. Indian Journal of Gerontology 2021;35(2).  Back to cited text no. 3
    
4.
Garnier-Crussard A, Forestier E, Gilbert T, Krolak-Salmon P. Novel coronavirus (COVID-19) epidemic: What are the risks for older patients? J Am Geriatr Soc 2020;68:939-40.  Back to cited text no. 4
    
5.
Kemenesi G, Kornya L, Tóth GE, Kurucz K, Zeghbib S, Somogyi BA, et al. Nursing homes and the elderly regarding the COVID-19 pandemic: Situation report from Hungary. Geroscience 2020;42:1093-9.  Back to cited text no. 5
    
6.
Moghadas SM, Vilches TN, Zhang K, Wells CR, Shoukat A, Singer BH, et al. The impact of vaccination on coronavirus disease 2019 (COVID-19) outbreaks in the United States. Clin Infect Dis 2021;73:2257-64.  Back to cited text no. 6
    
7.
DHS – Directorate of Health Services. Available from: https://dhs.kerala.gov.in/. [Last accessed on 2022 Jan 16].  Back to cited text no. 7
    
8.
Jain VK, Iyengar KP, Ish P. Elucidating causes of COVID-19 infection and related deaths after vaccination. Diabetes Metab Syndr 2021;15:102212.  Back to cited text no. 8
    
9.
Bergwerk M, Gonen T, Lustig Y, Amit S, Lipsitch M, Cohen C, et al. Covid-19 breakthrough infections in vaccinated health care workers. N Engl J Med 2021;385:1474-84.  Back to cited text no. 9
    
10.
Bernal JL, Andrews N, Gower C, Robertson C, Stowe J, Tessier E, et al. Effectiveness of the Pfizer-BioNTech and Oxford-AstraZeneca vaccines on COVID-19 related symptoms, hospital admissions, and mortality in older adults in England: test negative case-control study. bmj. 2021 May 13;373.  Back to cited text no. 10
    
11.
Abdool Karim SS, de Oliveira T. New SARS-CoV-2 variants – Clinical, public health, and vaccine implications. N Engl J Med 2021;384:1866-8.  Back to cited text no. 11
    
12.
Wall EC, Wu M, Harvey R, Kelly G, Warchal S, Sawyer C, et al. AZD1222-induced neutralising antibody activity against SARS-CoV-2 Delta VOC. Lancet 2021;398:207-9.  Back to cited text no. 12
    
13.
Planas D, Veyer D, Baidaliuk A, Staropoli I, Guivel-Benhassine F, Rajah MM, et al. Reduced sensitivity of SARS-CoV-2 variant Delta to antibody neutralization. Nature 2021;596(7871):276-80.  Back to cited text no. 13
    
14.
CDC COVID-19 Vaccine Breakthrough Case Investigations Team. COVID-19 vaccine breakthrough infections reported to CDC - United States, January 1-April 30, 2021. MMWR Morb Mortal Wkly Rep 2021;70:792-3.  Back to cited text no. 14
    
15.
Tyagi K, Ghosh A, Nair D, Dutta K, Singh Bhandari P, Ahmed Ansari I, et al. Breakthrough COVID19 infections after vaccinations in healthcare and other workers in a chronic care medical facility in New Delhi, India. Diabetes Metab Syndr 2021;15:1007-8.  Back to cited text no. 15
    
16.
Mishra S, Mindermann S, Sharma M, Whittaker C, Mellan TA, Wilton T, et al. Changing composition of SARS-CoV-2 lineages and rise of Delta variant in England. EClinicalMedicine 2021;39:101064.  Back to cited text no. 16
    
17.
Emary KR, Golubchik T, Aley PK, Ariani CV, Angus B, Bibi S, et al. Efficacy of ChAdOx1 nCoV-19 (AZD1222) vaccine against SARS-CoV-2 variant of concern 202012/01 (B.1.1.7): An exploratory analysis of a randomised controlled trial. Lancet 2021;397:1351-62.  Back to cited text no. 17
    
18.
Teran RA, Walblay KA, Shane EL, Xydis S, Gretsch S, Gagner A, et al. Postvaccination SARS-CoV-2 infections among skilled nursing facility residents and staff members – Chicago, illinois, December 2020-March 2021. MMWR Morb Mortal Wkly Rep 2021;70:632-8.  Back to cited text no. 18
    
19.
Dhama K, Patel SK, Kumar R, Rana J, Yatoo MI, Kumar A, et al. Geriatric population during the COVID-19 pandemic: Problems, considerations, exigencies, and beyond. Front Public Health 2020;8:574198.  Back to cited text no. 19
    
20.
Mudgal P, Wardhan R. The increased risk of elderly population in India in COVID-19 pandemic. Int J Health Sci Res 2020;10:166-175.  Back to cited text no. 20
    


    Figures

  [Figure 1], [Figure 2]
 
 
    Tables

  [Table 1], [Table 2]



 

Top
 
 
  Search
 
    Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
    Access Statistics
    Email Alert *
    Add to My List *
* Registration required (free)  

 
  In this article
    Abstract
   Introduction
    Materials and Me...
   Results
   Discussion
   Conclusion
    References
    Article Figures
    Article Tables

 Article Access Statistics
    Viewed436    
    Printed0    
    Emailed0    
    PDF Downloaded43    
    Comments [Add]    

Recommend this journal